ID: 929859373_929859379

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 929859373 929859379
Species Human (GRCh38) Human (GRCh38)
Location 2:45663328-45663350 2:45663357-45663379
Sequence CCCTTTTATAAAACAGTGAATTT CTGTGGGAATTCAAAGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 822} {0: 1, 1: 0, 2: 2, 3: 47, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!