ID: 929872852_929872856

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 929872852 929872856
Species Human (GRCh38) Human (GRCh38)
Location 2:45773184-45773206 2:45773211-45773233
Sequence CCCACAGTCTTCCAACTCTGCTC ATGTCACTGTCCCCAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 205} {0: 1, 1: 0, 2: 1, 3: 15, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!