ID: 929873678_929873691

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 929873678 929873691
Species Human (GRCh38) Human (GRCh38)
Location 2:45778521-45778543 2:45778572-45778594
Sequence CCCACTACTTTCACTCAGCGTCC CAGACACTAAGGGCTCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69} {0: 1, 1: 0, 2: 1, 3: 17, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!