|
Left Crispr |
Right Crispr |
| Crispr ID |
929890820 |
929890830 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:45917708-45917730
|
2:45917746-45917768
|
| Sequence |
CCGTGGAGCAGGGGGCGGCGCTC |
GCCGCACGGGAGCTCACGGTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 200, 1: 415, 2: 511, 3: 317, 4: 324} |
{0: 1, 1: 0, 2: 6, 3: 115, 4: 277} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|