ID: 929893933_929893936

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 929893933 929893936
Species Human (GRCh38) Human (GRCh38)
Location 2:45941696-45941718 2:45941717-45941739
Sequence CCTGGGTCACTGAGCAATTCAAG AGCATGCACTGGAAGAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216} {0: 1, 1: 0, 2: 4, 3: 17, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!