ID: 929893933_929893938

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 929893933 929893938
Species Human (GRCh38) Human (GRCh38)
Location 2:45941696-45941718 2:45941721-45941743
Sequence CCTGGGTCACTGAGCAATTCAAG TGCACTGGAAGAGCCTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216} {0: 1, 1: 1, 2: 6, 3: 29, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!