ID: 929897084_929897087

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 929897084 929897087
Species Human (GRCh38) Human (GRCh38)
Location 2:45970103-45970125 2:45970138-45970160
Sequence CCTTCCCTGTGCAGTCTCTGTGT CTTTCTGAAAACATGTCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 361} {0: 1, 1: 0, 2: 0, 3: 16, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!