ID: 929910514_929910517

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 929910514 929910517
Species Human (GRCh38) Human (GRCh38)
Location 2:46085605-46085627 2:46085623-46085645
Sequence CCTCCCTGACTCAGGTCTTCCTC TCCTCTACCTGCCTCTTATAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 223, 4: 2678} {0: 1, 1: 0, 2: 12, 3: 93, 4: 445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!