ID: 929913981_929913984

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 929913981 929913984
Species Human (GRCh38) Human (GRCh38)
Location 2:46118331-46118353 2:46118364-46118386
Sequence CCAAAGTTGGCCAAAGAGCTTGT CAATGATCTCAAATTGGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 107} {0: 1, 1: 0, 2: 0, 3: 13, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!