ID: 929915935_929915939

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 929915935 929915939
Species Human (GRCh38) Human (GRCh38)
Location 2:46135654-46135676 2:46135705-46135727
Sequence CCCAGAATGAAATATTATCTTTG AACTTGAAAAAAATTTACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 471} {0: 1, 1: 0, 2: 6, 3: 117, 4: 1315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!