ID: 929961728_929961739

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 929961728 929961739
Species Human (GRCh38) Human (GRCh38)
Location 2:46502348-46502370 2:46502381-46502403
Sequence CCCCAAACCCAAGATCCAAGTGT TAGTGGGTAAGCCTGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 252} {0: 1, 1: 0, 2: 1, 3: 16, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!