ID: 929966894_929966911

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 929966894 929966911
Species Human (GRCh38) Human (GRCh38)
Location 2:46542965-46542987 2:46542991-46543013
Sequence CCCCCCAGGCGGGCTGGGGCTGA CGGGGCCGGGGCGGGGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 272} {0: 3, 1: 4, 2: 59, 3: 473, 4: 2369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!