ID: 929966894_929966915

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 929966894 929966915
Species Human (GRCh38) Human (GRCh38)
Location 2:46542965-46542987 2:46542995-46543017
Sequence CCCCCCAGGCGGGCTGGGGCTGA GCCGGGGCGGGGGCTCCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 272} {0: 3, 1: 1, 2: 26, 3: 133, 4: 1098}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!