|
Left Crispr |
Right Crispr |
| Crispr ID |
929966895 |
929966913 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:46542966-46542988
|
2:46542993-46543015
|
| Sequence |
CCCCCAGGCGGGCTGGGGCTGAG |
GGGCCGGGGCGGGGGCTCCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 1, 3: 40, 4: 384} |
{0: 3, 1: 4, 2: 37, 3: 217, 4: 1422} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|