ID: 929966897_929966906

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 929966897 929966906
Species Human (GRCh38) Human (GRCh38)
Location 2:46542968-46542990 2:46542983-46543005
Sequence CCCAGGCGGGCTGGGGCTGAGCC GCTGAGCCCGGGGCCGGGGCGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 36, 4: 337} {0: 3, 1: 1, 2: 32, 3: 298, 4: 1571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!