|
Left Crispr |
Right Crispr |
Crispr ID |
929966898 |
929966911 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:46542969-46542991
|
2:46542991-46543013
|
Sequence |
CCAGGCGGGCTGGGGCTGAGCCC |
CGGGGCCGGGGCGGGGGCTCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 2, 2: 6, 3: 47, 4: 397} |
{0: 3, 1: 4, 2: 59, 3: 473, 4: 2369} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|