ID: 929974062_929974065

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 929974062 929974065
Species Human (GRCh38) Human (GRCh38)
Location 2:46615019-46615041 2:46615064-46615086
Sequence CCAGAACAGATGCACAACCATGT AAGTTCTCCAAGAAGAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 15, 4: 123} {0: 1, 1: 2, 2: 2, 3: 31, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!