ID: 929974603_929974612

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 929974603 929974612
Species Human (GRCh38) Human (GRCh38)
Location 2:46620236-46620258 2:46620283-46620305
Sequence CCCAGGAGTTTGAGAGCAGCCTG CAAAGGACAGAAAAATTAACTGG
Strand - +
Off-target summary {0: 227, 1: 11638, 2: 21598, 3: 30735, 4: 26883} {0: 1, 1: 0, 2: 5, 3: 196, 4: 3742}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!