ID: 929974610_929974617

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 929974610 929974617
Species Human (GRCh38) Human (GRCh38)
Location 2:46620274-46620296 2:46620323-46620345
Sequence CCTGTCCTACAAAGGACAGAAAA TGTAGTCCCAGCTACTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 341} {0: 40849, 1: 157871, 2: 218647, 3: 208196, 4: 128589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!