ID: 929989289_929989294

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 929989289 929989294
Species Human (GRCh38) Human (GRCh38)
Location 2:46771763-46771785 2:46771786-46771808
Sequence CCGTCCTGGCCCTTGCTGCATCC TGAGAGCCCAGCCCAGTGCTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 39, 4: 395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!