ID: 930011402_930011414

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 930011402 930011414
Species Human (GRCh38) Human (GRCh38)
Location 2:46940988-46941010 2:46941023-46941045
Sequence CCCCCGGGCGCCGGGGCTCCGCG GAGCTCCGACTCCGCGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 286} {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!