ID: 930011436_930011450

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 930011436 930011450
Species Human (GRCh38) Human (GRCh38)
Location 2:46941094-46941116 2:46941145-46941167
Sequence CCTGGCTGCTGTGGCCGCGCTGG TCCCCACGCCCCCGCGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 271} {0: 1, 1: 0, 2: 3, 3: 22, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!