ID: 930020868_930020881

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 930020868 930020881
Species Human (GRCh38) Human (GRCh38)
Location 2:47001419-47001441 2:47001464-47001486
Sequence CCCTGGGACCTTATGCAAGGTAG CCTCATCTGCAGAGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133} {0: 1, 1: 0, 2: 5, 3: 34, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!