ID: 930026424_930026429

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 930026424 930026429
Species Human (GRCh38) Human (GRCh38)
Location 2:47031900-47031922 2:47031921-47031943
Sequence CCACTCGTGGCTCCCCATCAGCT CTTCCTTGACTCTCACCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 178} {0: 1, 1: 0, 2: 2, 3: 18, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!