ID: 930030476_930030484

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 930030476 930030484
Species Human (GRCh38) Human (GRCh38)
Location 2:47055580-47055602 2:47055607-47055629
Sequence CCCATGATCCCAGGTCACGGCTC AGCTGACAGTGGGCCAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 72} {0: 1, 1: 0, 2: 3, 3: 27, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!