ID: 930035720_930035725

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 930035720 930035725
Species Human (GRCh38) Human (GRCh38)
Location 2:47083941-47083963 2:47083961-47083983
Sequence CCCCAGAAAATCATGTAGGAGTG GTGCAGTTGGCCGGCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181} {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!