ID: 930090040_930090050

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 930090040 930090050
Species Human (GRCh38) Human (GRCh38)
Location 2:47525423-47525445 2:47525469-47525491
Sequence CCAGAGTGGAGCATGGTGAGGGT CCTGGAGTCCAGAGCTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 156} {0: 1, 1: 0, 2: 3, 3: 44, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!