ID: 930113914_930113917

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 930113914 930113917
Species Human (GRCh38) Human (GRCh38)
Location 2:47702432-47702454 2:47702454-47702476
Sequence CCTGTTGTAGCAGACCAAAATGC CCACCCCAAAACATGACTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121} {0: 3, 1: 17, 2: 32, 3: 56, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!