ID: 930126084_930126087

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 930126084 930126087
Species Human (GRCh38) Human (GRCh38)
Location 2:47797981-47798003 2:47797994-47798016
Sequence CCCACTCTGCTTCCTTCATAATG CTTCATAATGCTGCTTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 295} {0: 1, 1: 0, 2: 6, 3: 25, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!