ID: 930136321_930136334

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 930136321 930136334
Species Human (GRCh38) Human (GRCh38)
Location 2:47906453-47906475 2:47906504-47906526
Sequence CCGTGGCAGGAGGAGCCATTGAC GTCCCTCCCCGCCGCGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 978} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!