ID: 930156792_930156799

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 930156792 930156799
Species Human (GRCh38) Human (GRCh38)
Location 2:48114123-48114145 2:48114172-48114194
Sequence CCTAGTTTCATTTCTGTTTTCAG AGCTTCTGAGCATCTATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 98, 4: 790} {0: 1, 1: 0, 2: 0, 3: 14, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!