ID: 930191593_930191598

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 930191593 930191598
Species Human (GRCh38) Human (GRCh38)
Location 2:48465723-48465745 2:48465771-48465793
Sequence CCATCCAAGTACTGCAAAGGACA TTTACTCTCAAAATAAAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 60, 4: 209} {0: 1, 1: 0, 2: 6, 3: 53, 4: 686}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!