ID: 930207382_930207390

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 930207382 930207390
Species Human (GRCh38) Human (GRCh38)
Location 2:48601726-48601748 2:48601773-48601795
Sequence CCTAGGGTTTTGTGGGCCATGGA CCCTGGAAGGCTTTGTGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154} {0: 1, 1: 1, 2: 3, 3: 27, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!