|
Left Crispr |
Right Crispr |
| Crispr ID |
930213635 |
930213639 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:48670220-48670242
|
2:48670239-48670261
|
| Sequence |
CCTGTCTTTACTAATAAAACAAA |
CAAAAATTAGCAGGGCATGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 51, 2: 6010, 3: 188511, 4: 227177} |
{0: 857, 1: 34861, 2: 109636, 3: 190270, 4: 202449} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|