ID: 930215942_930215944

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 930215942 930215944
Species Human (GRCh38) Human (GRCh38)
Location 2:48697437-48697459 2:48697484-48697506
Sequence CCTCAGGCTTTCACACAGTATTT TGTTTTGGAAGATCAGTTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 251} {0: 1, 1: 0, 2: 0, 3: 26, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!