|
Left Crispr |
Right Crispr |
| Crispr ID |
930335921 |
930335927 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:50045525-50045547
|
2:50045563-50045585
|
| Sequence |
CCTTCCTCCTTCCCCTCACAGAC |
TAAGAGATGAATAAATCAACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 11, 3: 91, 4: 1007} |
{0: 1, 1: 0, 2: 0, 3: 29, 4: 438} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|