ID: 930345010_930345012

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 930345010 930345012
Species Human (GRCh38) Human (GRCh38)
Location 2:50169309-50169331 2:50169323-50169345
Sequence CCCATGAGAACAAGCAATGGGTA CAATGGGTACCTTGCCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 288} {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!