ID: 930372693_930372701

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 930372693 930372701
Species Human (GRCh38) Human (GRCh38)
Location 2:50524139-50524161 2:50524189-50524211
Sequence CCCCAGAGATCATGAGTTTATTA GTCCCTGAGGACGGGTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 275} {0: 1, 1: 0, 2: 5, 3: 74, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!