|
Left Crispr |
Right Crispr |
| Crispr ID |
930377565 |
930377569 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:50587195-50587217
|
2:50587223-50587245
|
| Sequence |
CCTGTTTTGGCCAGGCATGGTGG |
ACCTGTAATCCCAACTCTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 28, 2: 174, 3: 703, 4: 2141} |
{0: 47, 1: 6363, 2: 102483, 3: 351576, 4: 357259} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|