|
Left Crispr |
Right Crispr |
| Crispr ID |
930377565 |
930377574 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:50587195-50587217
|
2:50587235-50587257
|
| Sequence |
CCTGTTTTGGCCAGGCATGGTGG |
AACTCTTTGGGAGGCTGATGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 28, 2: 174, 3: 703, 4: 2141} |
{0: 3, 1: 94, 2: 6289, 3: 81527, 4: 185866} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|