ID: 930377800_930377809

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 930377800 930377809
Species Human (GRCh38) Human (GRCh38)
Location 2:50589598-50589620 2:50589639-50589661
Sequence CCCACATCAGACTCCCAAAGAGT CCACCATGCCTGGCCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 127, 3: 4895, 4: 56576} {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!