ID: 930377801_930377809

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 930377801 930377809
Species Human (GRCh38) Human (GRCh38)
Location 2:50589599-50589621 2:50589639-50589661
Sequence CCACATCAGACTCCCAAAGAGTT CCACCATGCCTGGCCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 191, 3: 7597, 4: 87183} {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!