|
Left Crispr |
Right Crispr |
| Crispr ID |
930377806 |
930377809 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:50589612-50589634
|
2:50589639-50589661
|
| Sequence |
CCAAAGAGTTGGGATTACAGGTG |
CCACCATGCCTGGCCAAAACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 47, 1: 6055, 2: 92127, 3: 261405, 4: 340893} |
{0: 6, 1: 28, 2: 174, 3: 703, 4: 2141} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|