ID: 930435920_930435922

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 930435920 930435922
Species Human (GRCh38) Human (GRCh38)
Location 2:51341941-51341963 2:51341974-51341996
Sequence CCAGTATGGTTCTGACAAGGTTA CTTAAACTGTATATGTAGATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!