ID: 930455763_930455767

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 930455763 930455767
Species Human (GRCh38) Human (GRCh38)
Location 2:51605757-51605779 2:51605781-51605803
Sequence CCCTGGCACTGGCAGGGGAAAAC GCCGACTGGAGCCACAGTGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!