ID: 930507210_930507213

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 930507210 930507213
Species Human (GRCh38) Human (GRCh38)
Location 2:52298491-52298513 2:52298510-52298532
Sequence CCGTTGGAAGAAAATGCCATCTA TCTAGGAATTTTATAGCTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 40, 3: 341, 4: 1482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!