ID: 930509812_930509814

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 930509812 930509814
Species Human (GRCh38) Human (GRCh38)
Location 2:52330248-52330270 2:52330301-52330323
Sequence CCACATTCTCACTCATATGCAGC GAACACTGGTTAGCAGAGACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!