ID: 930527549_930527557

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 930527549 930527557
Species Human (GRCh38) Human (GRCh38)
Location 2:52548819-52548841 2:52548859-52548881
Sequence CCAGGCAGCATTTACCCCAAAGT CTTTAAGAGAAACTTGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 88, 4: 495} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!