ID: 930527550_930527560

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 930527550 930527560
Species Human (GRCh38) Human (GRCh38)
Location 2:52548833-52548855 2:52548886-52548908
Sequence CCCCAAAGTGACTGAAGAGACCT TAATCTGGCAGTACTCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 36, 3: 238, 4: 602} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!