ID: 930527552_930527558

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 930527552 930527558
Species Human (GRCh38) Human (GRCh38)
Location 2:52548835-52548857 2:52548860-52548882
Sequence CCAAAGTGACTGAAGAGACCTGG TTTAAGAGAAACTTGGCACTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!